WWW.LIB.KNIGI-X.RU
БЕСПЛАТНАЯ  ИНТЕРНЕТ  БИБЛИОТЕКА - Электронные матриалы
 

«ЗАЩИТА ЭКСПРЕССИИ ГЕТЕРОЛОГИЧНЫХ ГЕНОВ В ТРАНСГЕННЫХ РАСТЕНИЯХ ПОСРЕДСТВОМ ДНК-ПОСЛЕДОВАТЕЛЬНОСТЕЙ, ТЕРМИНИРУЮЩИХ ТРАНСКРИПЦИЮ. ...»

На правах рукописи

Долгова Анна Сергеевна

ЗАЩИТА ЭКСПРЕССИИ ГЕТЕРОЛОГИЧНЫХ ГЕНОВ В ТРАНСГЕННЫХ

РАСТЕНИЯХ ПОСРЕДСТВОМ ДНК-ПОСЛЕДОВАТЕЛЬНОСТЕЙ,

ТЕРМИНИРУЮЩИХ ТРАНСКРИПЦИЮ.

Специальность 03.01.07 – молекулярная генетика

АВТОРЕФЕРАТ

диссертации на соискание ученой степени

кандидата биологических наук

Москва

Работа выполнена в лаборатории регуляции генетических процессов Федерального государственного бюджетного учреждения науки Института биологии гена Российской академии наук

Научный руководитель: Георгиев Павел Георгиевич, академик, доктор биологических наук, профессор.

Официальные оппоненты: Голденкова-Павлова Ирина Васильевна, доктор биологических наук, доцент, Федеральное государственное бюджетное учреждение науки Институт физиологии растений им. К.А. Тимирязева Российской академии наук (ИФР РАН), заведующая группой функциональной геномики.

Шульга Ольга Альбертовна, кандидат химических наук, Федеральное государственное учреждение «Федеральный исследовательский центр «Фундаментальные основы биотехнологии» Российской академии наук» (ФИЦ Биотехнологии РАН), руководитель группы молекулярной биологии растений.

Ведущая организация: Федеральное государственное бюджетное учреждение науки Институт молекулярной генетики Российской академии наук (ИМГ РАН)

Защита состоится « 01 » декабря 2015 года в 11 часов на заседании диссертационного совета Д 002.037.01 при Федеральном государственном бюджетном учреждении науки Институте биологии гена Российской академии наук по адресу: 119334, г. Москва, ул. Вавилова, д. 34/5.

С диссертацией можно ознакомиться в библиотеке и на сайте Федерального государственного бюджетного учреждения науки Института биологии гена

Российской академии наук по адресу:

http://www.genebiology.ru/dissertation/dis-11-Dolgova/Dolgova-diss-text.pdf

Автореферат разослан: «________» 2015 года.

Ученый секретарь диссертационного совета, доктор биологических наук Набирочкина Е.Н.

1.

Общая характеристика работы

Актуальность проблемы Растения являются основным источником пищи для людей и кормов для сельскохозяйственных животных. Многолетние усилия селекционеров превратили растения в продовольственные культуры, которые являются основными источниками углеводов, липидов, белков, витаминов и минералов.

Методы традиционной селекции сельскохозяйственных культур к настоящему времени не могут удовлетворить растущие потребности человечества в продовольствии. Последние достижения биотехнологии растений открывают новые возможности для улучшения урожайности, качества и для удешевления производства сельскохозяйственных культур. В настоящее время для изменения сортов культурных растений всё чаще стала использоваться возможность непосредственного введения гетерологичных генов обуславливающих хозяйственно ценные признаки. Начиная с первого удачного эксперимента в 1983 году к 2014 уже более 18 миллионов производителей по всему миру выращивали трансгенные культуры на площади более 180 миллионов гектаров (James 2014). В последнее время генетическая инженерия растений является наиболее быстро распространяющейся технологией в сельскохозяйственном производстве (James 2014).

Эффективность использования генетически модифицированных растений напрямую зависит от возможности сохранения морфологических и физиологических характеристик культуры, а также достижения воспроизводимости результатов экспрессии измененного или привнесенного гена. Однако существует значительная вариация уровня экспрессии гетерологичных генов, которая всегда наблюдается в пределах популяции растений, трансформированных одной и той же конструкцией, одним и тем же методом и при одинаковых условиях. На данный момент известно несколько факторов вызывающих изменения уровня экспрессии гетерологичных генов в растениях. Это и непредсказуемое число интегрированных в геном копий, и место встройки, и уровень ее метилирования. Одной из главных проблем получения трансгенных растений с высоким уровнем экспрессии является так же и репрессия на посттранскрипционном уровне, что связано со сквозной транскрипцией, которая инициируюется в гетерологичном гене и в непосредственной близости от него в геноме. В результате формируется двухцепочечная РНК, которая запускает ряд процессов, приводящих к посттранскрипционному ингибированию гена (PTGS, post-transcriptional gene silencing - аналог РНКинтерференции у животных). Вариабельность экспрессии между трансформантами и PTGS сильно усложняют как фенотипический анализ, так и создание коммерчески выгодных линий с предсказуемыми характеристиками. Таким образом, одной из важных задач является разработка эффективных экспрессионных векторов и методов трансформации для получения трансгенных растений с искомым стабильным фенотипом и снижение различий в уровне экспрессии гетерологичных генов между индивидуальными растениями. Сегодня существует ряд стратегий и технологий, применяемых для получения предсказуемых уровней трансгенной экспрессии в растениях, однако, несмотря на разнообразие подходов, универсального эффективного способа все еще не найдено. В связи с этим весьма актуальным остается поиск путей решения этой проблемы.

Одним из наиболее перспективных подходов видится использование для этих целей регуляторных элементов различного происхождения, препятствующих PTGS.

Цели и задачи исследования

Цель работы заключалась в исследовании возможности применения ДНКэлементов, обладающих способностью останавливать транскрипцию для повышения уровня и стабильности экспрессии гетерологичных генов в растениях.

В связи с этим были поставлены следующие задачи:

1. Изучение влияния вирусных 35S CaMV и агробактериальных nos ДНКэлементов, терминирующих транскрипцию, на уровень экспрессии репортерных генов в трансгенных линиях растений табака.

2. Изучение влияния растительных ДНК элементов, терминирующих транскрипцию, на уровень экспрессии репортерных генов под промоторами разной силы и происхождения в трансгенных линиях растений табака.

3. Анализ влияния расположения ДНК элементов, терминирующих транскрипцию, на экспрессию гетерологичных генов в трансгенных линиях растений табака.

4. Оценка влияния ДНК элементов, терминирующих транскрипцию, на вариабельность экспрессии репортерных генов в трансгенных линиях растений табака.

Научная новизна и практическая значимость работы.

В работе были исследованы несколько ДНК-элементов, терминирующих транскрипцию, как вирусного, так и растительного происхождения. В результате впервые было показано, что присутствие в экспрессионной конструкции изучаемых ДНК-элементов (терминаторов транскрипции) в определенной позиции, позволяет существенно увеличить экспрессию репортерного гена в трансгенных растениях.

Так как терминаторы транскрипции имеют специфический механизм действия, то они могут быть эффективно использованы совместно с другими регуляторными элементами для синергетического усиления экспрессии гетерологичных генов в трансгенных растениях. Безусловно, для подтверждения этого предположения необходимо проведение дальнейших исследований, однако уже сейчас видно, что подобные элементы являются весьма перспективным методом создания более эффективных экспрессионных векторов для получения трансгенных растений.

Разработанный подход позволит увеличить производительность и ценность многих сельскохозяйственных культур, а также применяться в других областях биотехнологии, например, при экспрессии в растениях различных белков биомедицинского назначения.

Методология и методы исследования.

Работа выполнена с использованием современных методов молекулярной генетики, молекулярной биологии и генетической инженерии растений.

Основные положения, выносимые на защиту.

1. ДНК-элементы, содержащие последовательности терминаторов генов агробактерий nos и вирусов 35S CaMV, при локализации перед промотором усиливают экспрессию гетерологичных генов в растениях под сильным вирусным промотором 35S CaMV.

2 Расположение растительных ДНК-элементов, терминирующих транскрипцию (ATs), при любом расположении относительно кассеты экспрессии оказывает более сильное влияние на экспрессию генов под растительными промоторами по сравнению с вирусными.

3 Расположение ДНК-элементов как с одной, так и с обеих сторон экспрессионной кассеты усиливает экспрессию генов с сильного растительного промотора RuBisCO. ДНК-элементы, расположенные только с 5'-конца гена увеличивают уровень экспрессии с сильного вирусного промотора 35S CaMV.

4 Растительные AT-элементы, при размещении с обеих сторон экспрессионной кассеты снижают позиционный эффект и эффект копийности до двух раз при экспрессии, которая находится под контролем сильного растительного промотора RuBisCO.

Апробация работы

Настоящее исследование было представлено на следующих конференциях:

9th International Plant Molecular Biology Congress (USA, 2009), 14-я Международной Пущинской Школе-Конференции Молодых Ученых «Биология- Наука XXI Века» (Россия, 2010), Международной научнопрактической конференции молодых ученых «Современнная биотехнология:

фундаментальные проблемы, инновационные проекты и бионанотехнология»

(Россия, 2010), Всероссийской научной конференция «Ориентированные фундаментальные исследования и их реализация в области хранения и переработки сельскохозяйственной продукции» (Россия, 2010).

Публикации Основные положения диссертации опубликованы в Российском патенте RU 2507736 и статье в Plant Cell, Tissue and Organ Culture (PCTOC).

Структура и объем работы.

Диссертационная работа состоит из введения, обзора литературы, материалов и методов исследования, результатов и обсуждения, выводов и списка литературы. Работа изложена на 122 страницах машинописного текста, включает 19 таблиц, 9 рисунков. Список цитируемых литературных источников включает 241 наименований.

2. Результаты

2.1. Исследование роли искусственных ДНК элементов, которые прерывают (терминируют) транскрипцию.

2.1.1. Разработка и создание конструкций с искусственными ДНК элементами Целью настоящей работы стало исследование возможностей использования терминаторов транскрипции для защиты экспрессии трансгенов от репрессии на посттранскрипционном уровне. Предполагается, что такие элементы способны прерывать транскрипцию, которая инициируется вблизи места интеграции трансгенной конструкции в геноме. В результате конструкция оказывается полностью изолированной от геномной транскрипции, и репрессия, связанная с PTGS, не запускается. В качестве элементов, терминирующих транскрипцию, были использованы два варианта ДНК-последовательностей, которые в соответствии со своей структурой должны эффективно терминировать транскрипцию в растительных организмах. В первой части работы мы проводили исследования по влиянию на экспрессию гетерологичных генов двух новых искусственных регуляторных элементов, условно названных «элемент I» и «элемент II». В элементе I терминатор гена nos (247 пн) был окружен с одной стороны искусственно созданным в нашей лаборатории рибозимом (52 пн), с другой – ранее описанным рибозимом из бета глобинового гена (226 пн). Рибозим – это последовательность РНК с собственной ферментативной активностью, стимулирующей разрывы в РНК. Предполагается, что рибозимы усиливают активность терминатора транскрипции. Во втором ДНК-фрагменте (элемент II) вирусный терминатор гена CaMV 35S (210 пн) был совмещен с теми же двумя рибозимами. Таким образом, оба ДНК-фрагмента должны быть эффективными терминаторами транскрипции в растениях. Конструкции собирались на основе вектора pBI121, в котором Т-ДНК несет репортерный ген gusA под котролем 35S-промотора и нопалин-синтетазного терминатора nos, а также ген неомицинфосфотрансферазы nptII в качестве селективного маркера на устойчивость к канамицину. Для каждого элемента было создано по две конструкции в одной из которых элемент был встроен перед 35Sпромотором репортерного гена gusA, кодирующего белок -глюкуронидазы (GUS), а в другой фланкировал экспрессионную кассету с обеих сторон (Рис.1). Контрольная конструкция не содержала в своем составе дополнительных элементов.

Рисунок 1. Схематичное изображение использованных в работе конструкций.

Промоторы показаны в виде стрелок. 35S - 35S CaMV, промотор вируса мозаики цветной капусты; GUS – репортерный ген белка -глюкуронидазы; Tnos – терминатор нопалин синтазы; Pnos- промотор нопалин синтазы; nptII-ген устойчивости к канамицину; LB, RB

-последовательности левой и правой границ Т-ДНК;

2.1.2 Получение и анализ трансгенных растений табака Nicotiniana tabacum сорта Petite Havana SR1.

Для получения трансгенных растений плазмиды были перенесены в супервирулентный агробактериальный штамм CBE21, сконструированный на основе дикого штамма A. tumefaciens А281 с обезоруженной Ti-плазмидой pTiBo542 (Revenkova et al., 1993). Для трансформации использовались листовые экспланты табака.

Регенеранты были отобраны на селективной среде с канамицином в концентрации 50 мг/л. Каждое растение, полученное в результате единичного трансформационного события и устойчивое к селективному антибиотику, было впоследствии вегетативно размножено на шесть клонов. После проведения трансформации, клонального микроразмножения полученных растений до требуемого числа и укоренения, производился дальнейший их перевод в условия закрытого грунта.

Все полученные линии и клоны были проверены c помощью ПЦР-анализа на отсутствие агробактериальной контаминации, на вставку селективного маркера (кодирующая область nptII, терминатор nos), наличие репортерного гена gusA и исследуемых элементов. В результате в теплицу было перенесено по шесть трансгенных растений каждой линии.

Таблица 1. Результаты трансформации листовых эксплантов табака конструкциями с синтетическими элементами терминации транскрипции.

aКонструкции представлены на Рис.1

–  –  –

В каждой трансгенной линии определялась экспрессия гена gusA с помощью гистохимического анализа. Все трансгенные линии, в которых ген gusA не экспрессировался, не были использованы для дальнейшего анализа.

В результате, в последующих исследованиях использовалось 29 линий (более 150 растений) – контроль (7 линий), pBIGeI (4 линии), pBIGeI-I (6 линий), pBIGeII (6 линий), pBIGeII-II (6 линий) (табл. 1).

На следующем этапе измерение активности гена проводилось флюориметрически, что позволило количественно определить уровень экспрессии репортерного гена. Для этого был получен белковый экстракт из каждого растения, в качестве отрицательного контроля было использовано нетрансгенное растение табака. Измерение проводилось при помощи реактива 4-MUG (4-метилумбеллиферилглюкуронида), который при расщеплении -глюкуронидазой до 4-MU имеет оптимумы возбуждения при 365 нм и излучения при 455 нм. Количество репортерного белка оценивалось относительно общего белка экстракта, определение концентрации которого проводилось по методу Брэдфорд. Окончательная количественная оценка уровня наработки продукта репортерного гена была получена в следующей размерности: нмоль 4-MU/ мин на мг общего белка.

Полученные результаты (рис.2, табл.2) демонстрируют, что наличие в конструкции элементов, обеспечивающих терминацию транскрипции, перед промотором, приводит к увеличению уровня экспрессии репортерного гена gusA в 2-6 раз. При этом элемент II оказался примерно в два раза эффективней элемента I.

–  –  –

При расположении регуляторных элементов по обе стороны экспрессионной кассеты уровень экспрессии наоборот снижается. При этом можно видеть, что и первый и второй эффекты сильнее выражены при использовании элемента-II. Вероятно, это связано с тем, что второй элемент дублирует присутствующий в конструкции nos терминатор, который находится на конце гена неомицинфосфотрансферазы nptII (рис.1). В тоже время дупликация последовательностей в конструкции может приводить к повышению частоты перестроек и снижению эффективности экспрессии.

Ни один из тестируемых ДНК-элементов не оказывает положительного влияния на уменьшение вариабельности экспрессии. Это можно объяснить тем, что разброс экспрессии, запускаемой с 35S-промотора, зависит от транскрипционной активности хроматина в месте интеграции гетерологичного гена.

Рисунок 2. Активность GUS в мкмоль 4-метил-умбеллиферона в мин на мг общего белка с ± стандартной ошибкой всех измерений в каждой популяции.

Статистически достоверные отличия между группами и контролем отмечены одной звездочкой (p0,05) или двумя (p0,1).

Тестируемые элементы, которые прерывают транскрипцию, не могут защитить промотор от негативного/позитивного влияния окружающих геномных регуляторных факторов. С другой стороны, ДНК-элементы, терминирующие транскрипцию, прерывают синтез РНК, который инициируется в окружающих гетерологичный ген последовательностях.

Таким образом, происходит частичная супрессия эффекта РНКинтерференции, что приводит к увеличению экспрессии гетерологичного гена. Большинство других регуляторных элементов, используемых для увеличения экспрессии гетерологичного гена, непосредственно влияют на уровень транскрипции: сильные промоторы, А/Т-богатые ДНКпоследовательности, связывающие белки ядерного матрикса и др. Так как терминаторы транскрипции имеют отличный механизм действия, то они могут быть эффективно использованы совместно с другими регуляторными элементами для синергетического усиления экспрессии репортерных генов в трансгенных растениях.

2.2 Исследование влияния растительных ДНК элементов, которые терминируют транскрипцию, на уровень экспрессии репортерных генов:

2.2.1 Поиск растительных элементов терминирующих транскрипцию В настоящее время при получении трансгенных растений стараются избегать использования ДНК элементов не растительного происхождения.

Однако, на данный момент не описано ни одной растительной терминирующей последовательности, охарактеризованной по своему влиянию на трансгенную экспрессию. Таким образом, первым нашим шагом в достижении поставленной задачи был поиск ДНК элементов, терминирующих транскрипцию, в растительном геноме. В качестве донора регуляторных элементов было выбрано модельное растение Arabidopsis thaliana, для которого существует электронная база данных, содержащая полногеномный сиквенс. Для поиска терминирующих последовательностей в геноме можно опираться как на сайты полиаденилирования, так и на другие последовательности, способствующие эффективной терминации транскрипции.

Сайты полиаденилирования во всех растительных организмах состоят из трех главных частей:

1-сайт расщепления (CS-cleavage site), 2-аналог сайта полиаденилирования животных (NUE-near upstream element);

3-дополнительный регуляторный элемент (FUE - far upstream element);

NUE находится примерно за 10-30 нуклеотидов от CS и эквивалентен AATAAA животных (Loke et al., 2005). В 60-130 нуклеотидах в сторону 5'конца от сайта расщепления находится элемент FUE, не имеющий аналогов у животных. Этот элемент обычно представляет собой T/TG богатую последовательность (Li & Hunt, 1997; Zhao et al. 1999; Hu et al. 2005). В растениях консервативность этих элементов не высока, что затрудняет их идентификацию. При поиске ДНК-последовательностей, обладающих свойствами терминировать транскрипцию, высока вероятность того, что они будут располагаться между активно экспрессирующими генами, которые работают во все органах и структурах растения, на всех стадиях развития и рамки считывания которых направлены навстречу друг другу. В связи с этим, при поиске терминаторных последовательностей в растительном геноме мы придерживались следующих критериев: 1) гены активно транскрибируются в более чем 25 органах и не менее, чем на 15 стадиях развития 2) расстояние между 3' концами генов не более 1000 пар нуклеотидов. Поиск таких элементов проводился в Информационной Базе Арабидопсиса (TAIR) с использованием программы, основанной на методах математического моделирования (созд. Тихонов М.В.). Основываясь на вышесказанном нами были выбраны три терминирующих элемента, соответствующие заданным параметрам (рис. 3). Последовательности NUE и FUE, по которым проходила идентификация терминирующих последовательностей арабидопсиса (АТ Arabidopsis termination element) отмечены на рис. 3.

ATI 1407 bp

GTTGACCCAAGCACAGGTGAAGCAGAAGATGATGGAGTAGAAGATGAGTACCAGCT

AGAGGATCTTGAGGTTGTAGCTGGAGATTACATGGTGAAAGTGGGTGTCTCCAATTTC

AGGAATGCGTGGGAAAGCATGGATGAAGAAGATGAGCGTGTAGACGAATATGGCCTT

GGCCAAAGAGAGAGTTTGGGAGAAGCTGTAAAGGCTGTCATGGATCTTCTTGGCATG

CAGACTTGTGAGgttagtctcttccacttttttctcatactctactgagacttgagggctaaaattattgttgataaagtcttttttga gtatatgaccatttgttgtgttcctgaaattgaaactgacactggataaataacagGGGACGGAGACAATTCCGCTCA

ATGCAAGGTCACACACGTGTCTATTGTCAGGTGTGTACATAGGCAACGTGAAAGTGTT

AGTGAGGGCACAGTTTGGAATGGACAGCTCAAAGGACATTGCAATGAAGCTGACAG

TTAGAGCTGAAGACGTTTCTGTCGCCGAGGCCATTCACGAGATTGTTGCCAGCGGCT

AAaacctcttgcgtttcttcagtatcagagaatgtcatctattcctgctgctaaacctcaaaaatacatcaactattataaatagcatagtattact ttctttcttttttccttgcattattactgtcaaatacactatggaggttttctttttattttatgacggtgctttttgatttctcatttctgaattttattattaccc gttttctcgccaagttgggaatctacagatcatcttgctcggatttgaaaaccactaccgtaccgtacaacaggctaggctttctccataagtta gaaactcaaaaatagtagcgttttatcgtctgcgttcaatatgaagagatgatagtaaagtaaagactggtgggtacacaattgattacagaatt cacattgagtagcgtgttgaaggagtttagttcccaatgaagaaataaataaatcaaagcacactacaaaaagggaagtttaattcttctaacc actccactatttcaaaccaaacaccttccacaaaccgaaccttacttcccgactacagaatatattaaccaacaactggagacgtgactcctac tttcgttaaatcttctTCAAATCACTCTCCTGTGTCCTCCAAACGCCCATATctgtgtgaattcaacgaaattt catctatcctctaatttccttacaaacataacatggtaaatgataagcagagacactactaagtactaacCTTTAGATTTGAAT

CCCAACTTCCTGTACACAAGGCACTTCCATCTGCTGACAACCCCAAACAGCTTATTCT

ATTCCTGTGTGAATCCTGCTGTAATCCCAAATCCAATACAAC

ATII1400 bp

CCTGACATTATCGATTCAGCTCTTCTCCGTCCTGGAAGGCTTGACCAGCTCATTTACAT

TCCACTACCAGATGAGGATTCCCGTCTCAATATCTTCAAGGCCGCCTTGAGGAAATCT

CCTATTGCTAAAGATGTAGACATCGGTGCACTTGCTAAATACACTCAGGGTTTCAGTG

GTGCTGATATCACTGAGATTTGCCAGAGAGCTTGCAAGTACGCCATCAGAGAAAACA

TTGAGAAGgttagagatcccatcgccaagctctttatccaaagattgttatactctccaatcgttgaactgaagctcatgtttttttttt

gtttcagGACATTGAAAAGGAGAAGAGGAGGAGCGAGAACCCAGAGGCAATGGAGGAA

GATGGAGTGGATGAAGTATCAGAGATCAAAGCTGCACACTTTGAGGAGTCGATGAAG

TATGCGCGTAGGAGTGTGAGTGATGCAGACATCAGGAAGTACCAAGCCTTTGCTCAG

ACGTTGCAGCAGTCTAGAGGGTTCGGTTCTGAGTTCAGGTTCGAGAATTCTGCTGGT

TCAGGTGCCACCACTGGAGTCGCAGATCCGTTTGCCACGTCTGCAGCCGCTGCTGGG

GACGATGATGATCTCTACAATTAGtgataacttctttatcctttttttttttaagttttaaaactcgaattctctacttttggattac tggggaaagtgatactgattctttcctcgtgtttttaagttatccgaatctcttgtgtttgggttttaatcaatgttcttaattttcgtttcaatacttgttt ggtcgttcattacaaatggaaaaaataaaggattataaagtaagttaaaaagattgcaagtgataagtaattgctttataagtggtaagtatcac aaatgttcccacttatcagcaatttccgcatatcaatgttaatgctctaagatcggtactttcttttatagaatcttggagccgaggatgtattttttttt gcatcaatggtggttaaagaagccaaaagaaaggatgctttattatgtcaacaacattgatgtcaagataacaacaaagctgctcccaagtctt aaacataaattgaacaaaggccacatgttgaagattgaagatgaacatacttaaaaacgatatcttactgttcttgttcaaacattgaccgttaaa tacttcaatgtTTAGCCTTCAGCACCTATTCCACGTGCTCTAGGACGTCTGACAGCGACCAG

CGGATTGACTATGCCTTGTGACTCTCTACCCAGACCCGAGCCTTCGACGAAACCCATT

CTCGCCATCATCCTCGACCCAAAGCCTGTTGTGTGCTGCTCAAAGGCTCCCAATCTTT

TGTCCCTGATTCTTCCTGAACCAGAGGCACCATTGTC

ATIV 1051 bp

GTCTGTGCCATCTGGTGGTGGTGTGGCTGTTTCAGCTGCTCCATCAAGCGGTGGTGGT

GGTGCTGCTGCCCCTGCGGAGAAGAAAGAAGCCAAGAAGGAAGAGAAAGAAGAGT

CTGATGATgtaaagcatttctctctttatcattttgtttccttattacttagtctttgttatggtcttgatattggtctttatctgactctttgttat atccttcacctttgatgcagGACATGGGATTCAGTCTCTTCGAGTAAggtttttgtccccacggaaaggagtcgaga tttgattttttgttctcttagtggttctggtttttgcttcttggattacgaattttactccttagataatgaagcaagaagagttttttcaactatgttgcga ccttgcgggttattcatttatcgttttccgtttgatttacatgttgaatctggtctaagcttgtaatttacatagtttagttcatagtatgttagcatatca caaaataagtgcctaagagggctagaatttgatacactcatggaaaagtttatctttagtgatcccaaataaacagaaaaatccaaatccaagt gaaattgagattctatgttattaacttcaaacattggtgttgtcgtgttgtcgtttcagacataaacccatgaagcttggataaattagaagaaagt agatcaactctatttcaagaaaataagaggaattgaagtaacattagaagttgaagtctttttgttcactaagcattctcataaaatttgtttgacaa aaacataaaataatgtttagtgtcaagaagatgatgccaccaacttaacctgatctgctcgggtacaacaaacatatcccacagttcgatccat ctccgcaagaacaacttcccagcatagaaccaatcacggggttacggatcagcatagattgttcactatctttgagacagtagcaaagatgC

TAAGATTTCGGAACGGTGACATTAAGTATCTTCACATCTTGGTAAGGCCTGTCGTTCTT

GTCTGTCTTCACTTTCTCTATACC

Рисунок 3. Терминаторные последовательности Заглавными буквами обозначены экзоны; курсивом - интроны; строчными некодирующие последовательности; жирным шрифтом - стоп кодоны; красным - AATAAA последовательность NUE DIR; зеленым - AATAAA последовательность NUE REV;

желтым - потенциальные NUE DIR; салатовым - потенциальные NUE REV; красным подчеркнуты последовательности FUE DIR; зеленым подчеркнуты последовательности FUE REV.

Три выбранных АТ-элемента с дополнительными участками выше обоих стоп-кодонов были клонированы из генома Arabidopsis thaliana с использованием метода ПЦР.

• AT I – последовательность между генами субъединицы коатомера гамма-2 (локус AT4G34450) и гуанин нуклеотид-связывающего белка AGB1 (локус AT4G34460) - 1407 пн.

• AT II – последовательность между генами белка цикла клеточного деления CDC48 (локус AT3G09840) и белка содержащего D111/G-patch домен (локус AT3G09850). – 1400 пн.

• AT I-IV – последовательность между генами 60S субъединицы рибосомного белка P2 (RPP2D) (локус AT3G44590) и циклофилина 71 (локусAT3G44600). – 1051 пн.

2.2.2 Разработка и создание конструкций с терминаторными элементами растений.

Для анализа влияния полученных элементов на уровень экспрессии генов в растениях, эти последовательности были сгруппированы нами в два кластера, один из которых состоял из элементов ATI и ATIV, второй содержал ATII (рис.4). В качестве репортерных генов для последующей оценки показателей уровня экспрессии был взят ген -глюкуронидазы (GUS), и ген зеленого флуоресцентного белка еGFP (модифицированный вариант GFP для экспрессии в растениях).

В создаваемых экспрессионных векторах оба репортерных гена были помещены под промоторы разной силы и природы (вирусной или растительной), что в дальнейшем позволило произвести более полный и многосторонний анализ изменения экспрессии, при использовании регуляторных элементов. Использовалось два промотора вирусного происхождения: 35S CaMV наиболее часто используемый при трансформации растений сильный промотор и его минимальная функциональный единица (35Smin). В качестве растительных промоторов – RuBisCO, наиболее часто используемый растительный промотор, и ELIP, светоиндуцибельный промотор из генома томата.

• 35S CaMV – полный промотор вируса мозаики цветной капусты, 350нуклеотидных пар, который включает минимальный промотор и последовательности, усиливающие активность промотора.

• 35Smin - минимальная единица CaMV 35S промотора, обеспечивающая инициацию транскрипции, представляющая собой 57-нуклеотидный фрагмент (от -49 до +8).

• RuBisCO - сильный растительный промотор малой субъединицы рибулозо-1,5-бисфосфат карбоксилазы томата (RuBisCO) c 250 нуклеотидным интроном, представляющим собой комбинацию 5'UTR последовательности гена фосфоенолпируват карбоксилазы томата (сорт Ялф) и энхансера (синтетический двойной энхансер ocs агробактериального промотора октопин синтазы), длиной 1437 нп.

• ELIP - слабый уникальный укороченный промотор белка светового стресса томата ELIP (Bruno & Wetzel, 2004) длиной 402 пн.

Сборка экспрессионных конструкций проводилась в векторе pHANNIBAL (с геном -лактамазы в качестве бактериального маркера). Из этого вектора по сайтам NotI была вырезана смысловая конструкция и встроен синтезированный нами полилинкер. После сборки каждая из шести экспрессионных кассет (рис. 4) по фланкирующим сайтам рестрикции из вектора, использующегося для сборки кассет, рядом последовательных клонирований была перемещена непосредственно в вектор pART27 (Gleave, 1992), который в дальнейшем использовался для трансформации растительных тканей.

Рисунок 4. Схематичное изображение использованных в работе конструкций.

Промоторы показаны в виде стрелок. Обозначения: 35S, промотор CaMV 35S; 35Smin, -49 to +8 участок промотора CaMV 35S, RuBisCO, промотор гена малой субъединицы рибулозо-1,5-бисфосфат карбоксилазы томата (rbcS) c интроном, ELIP, укороченный по HindIII сайту промотор белка светового стресса ELIP; GUS – ген белка -глюкуронидазы, еGFP- ген зеленого флуоресцентного белка GFP, модифицированного для экспрессии в растениях, LB, RB -последовательности левой и правой границ Т-ДНК, Tnos – терминатор нопалин синтазы; Pnos- промотор нопалин синтазы; nptII-ген устойчивости к канамицину.

2.2.3 Получение и анализ трансгенных растений табака Nicotiniana tabacum сорта Petite Havana SR1.

Трансформация проводилась по той же методике, что и в первом эксперименте (табл. 3).

Таблица 3. Результаты трансформации листовых эксплантов табака конструкциями с растительными элементами терминации транскрипции.

aКонструкции представлены на Рис.4

–  –  –

Каждой конструкцией было протрансформировано по 50 эксплантов.

Полученные регенеранты в дальнейшем селектировались на среде с канамицином и проверены на наличие экспрессии GFP микроскопированием.

Каждая линия также гистохимически проверялась на наличие экспрессии GUS, для первоначального подтверждения наличия экспрессионной конструкции в геноме растения. Растения с детектируемой экспрессией GFP и GUS клонально размножались в условиях in vitro. По шесть клонов было адаптировано и перенесено в условия защищенного грунта. Все линии были проверены на отсутствие бактериальной контаминациии и на присутствие гена селективного маркера методом ПЦР. Так как перенос Т-ДНК осуществляется от правой к левой границы, то присутствие селективного маркера, расположенного у левой границы, с высокой долей вероятности свидетельствует об успешном переносе полноразмерной кассеты экспрессии.

Уровень экспрессии GUS измерялся флюориметрически, тем же методом, что и в первом эксперименте. Исследование количества и уровня экспрессии репортерного белка GFP проводилось методом иммуноферментного анализа (табл. 4). Определение общего белка экстракта проводилось, как и в первом случае, по методике Бредфорд.

Данные представленные в таблице 4 и в рисунке 5, свидетельствуют о том, что влияние на экспрессию с промотора 35S в сторону ее увеличения оказывают лишь регуляторные элементы, находящиеся только с одной стороны от экспрессионной кассеты (в конструкции pBI35SI-IV), что согласуется с предыдущими результатами, для регуляторных элементов I и II.

Однако в случае сильного растительного промотора RuBisCO это влияние хорошо выражено в конструкциях и pBIERI-IV и pBIERII. Более того, при фланкировании регуляторными элементами экспрессионной кассеты с обеих сторон, влияние на экспрессию под промотором RuBisCO сильнее, чем при расположении только выше по ходу транскрипции. Для промотора ELIP увеличение уровня экспрессии в конструкции pBIERII так же сильнее чем в pBIERI-IV, однако, влияние элементов выражено гораздо слабее, чем для RuBisCO. Ни одна из комбинаций элементов не влияет на экспрессию, находящуюся под 35Smin - минимальным промотором.

Таблица 4. Активность GUS и уровень экспрессии GFP в трансгенных растениях табака.

a Конструкции представлены на Рис.4 b Количество трансгенных линий табака с детектируемой активностью GUS и уровнем экспрессии GFP.

c Средняя активность GUS в нмоль 4- MU ·мин-1·мг общего растворимого белка-1 d Средний уровень экспрессии GFP в мкг· мг общего растворимого белка -1

–  –  –

A Б Рисунок 5. Влияние АT-элементов на экспрессию GFP и активность GUS в трансгенных растениях табака. (A) Средний уровень экспрессии eGFP в мкг на мг общего растворимого белка ± стандартная ошибка (SE); (Б) Средняя активность GUS в нмоль 4-метил-умбеллиферона в мин на мг общего белка с ± стандартной ошибкой (SE).

Статистически достоверные отличия между группами и контролем отмечены одной звездочкой (p0,05) или двумя (p0,1).

3. Статистическая обработка и анализ результатов При анализе данных нельзя остановиться только лишь на сравнении сдвига средних между группами и игнорировать не менее важные параметры распределения признака, такие как меры рассеяния (дисперсия, размах) и меры формы (эксцесс и ассиметрия). Для подобных расчетов необходимо применять методы математической статистики, такие как метод ANOVA (ANALYSIS OF VARIANCE).

Наиболее адекватным методом для решения нашей задачи было проведение двухфакторного иерархического дисперсионного анализа, где в качестве первого фиксированного фактора выступало наличие изучаемых элементов в конструкции, а в качестве второго (случайного) - возможные различия между линиями с одной экспрессионной конструкцией. ANOVA представляет собой мощный и чувствительный статистический метод, направленный на поиск зависимостей в экспериментальных данных путём исследования значимости различий в средних значениях. В отличие от tкритерия позволяет сравнивать более двух групп. Для ее применения данные должны соответствовать следующим критериям: 1) независимость выборок,

2) нормальное распределение совокупности, 3) равенство дисперсий выборок (достигается уравниванием числа значений в каждом из комплексов).

Для сглаживания распределения наши данные были прологарифмированы по основанию 10 и случайным образом были отобраны линии, которые исключались из исследования для уравнивания числа значений в выборках.

Нормальность распределения выборок для эксперимента с синтетическими элементами была подтверждена критерием Райана-Джойнера (идентичен тесту Шапиро-Уилка), а для растительных - тестом Колмогорова-Смирнова.

Равенство дисперсий подтверждено критериями Левена и Бартлетта. После проведенного анализа данных на правомочность применения к ним метода ANOVA, было проверено непосредственно само влияние элементов на экспрессию генов. В данном случае фактор 1 – это данные по конструкциям, он фиксирован. Фактор 2 – по линиям внутри конструкций, это случайный фактор. Принятие во внимание второго фактора позволяет оценить влияние изучаемых нами регуляторных элементов на экспрессию репортерных генов под разными промоторами, нивелируя влияние места встраивания экспрессионной кассеты и ее копийности, т.к. все это включает в себя анализ данных в качестве влияющего фактора. Такой подход позволяет обойтись без дополнительных экспериментов, таких, например, как Саузерн блот. Анализ ANOVA показал, что и синтетические и/или растительные терминаторные элементы влияют на экспрессию с промоторов 35S, RuBisCO и ELIP, однако ATs не влияют в случае промотора 35Smin. Критерий Даннета подтвердил эффект терминаторных элементов для всех вариантов, кроме 35S-gusA экспрессии в pBIGeII-II, 35S-egfp экспрессии в pBI35SII и ELIP-gusA экспрессии в pBIERIIV.

^ Для величины эффекта f видно, что наибольший эффект фактор производит на гены, находящиеся под промотором RuBisCO (0.25), чуть менее на 35S (0.22 для синтетических и 0.2 для растительных элементов соответственно), еще слабее эффект для ELIP (0.17). Анализ дельты Кохена согласуется с результатами критерия Даннета, дополнительно указывая на направление влияния фактора. При фланкировании экспрессионной кассеты с обеих сторон, элементы не оказывают влияния на экспрессию с 35S промотора (кроме незначительных показателей для pBIGeI-I). При расположении выше экспрессионной кассеты влияние вирусных последовательностей на 35S-экспрессию вполне сравнимо с растительными, в такой же ориентации. Для конструкции pBIGeII d(Cohen)0.8, а для растительных элементов pBI35SI-IV d(Cohen)0.

7. Эффект ATs на ELIP- и RuBisCO-зависимую экспрессию в pBIERII и pBIERIIV примерно одинаков (~0.5 по дельте Кохена). Наиболее сильный эффект ATs имеют в pBIERII, где экспрессия идет под контролем промотора RuBisCO. Эти результаты подтверждаются и вычислением общей дисперсии приписываемая эффекту 2 (Эта в квадрате). Статистический анализ так же показывает и другую важную закономерность. Для сильных промоторов (CaMW 35S или RuBisCO) большая составляющая компоненты дисперсии (около 60%) приходится на различие данных по отдельным линиям, а для слабых промоторов ситуация прямо противоположная и большая часть вариабельности вызвана межклональным различием. Однако для RuBisCO расположение ATs с двух сторон от экспрессионной кассеты позволяет в два раза снизить уровень вариабельности между линиями.

Таким образом, видно, что ни одна из комбинаций элементов не влияет на экспрессию, находящуюся под 35Smin - минимальным промотором. На экспрессию как GUS, так и GFP под 35S промотором влияет расположение элементов только с одной стороны от экспрессионной кассеты, причем это оказывается верным как для растительных, так и для синтетических регуляторных элементов, содержащих вирусные терминаторы. На экспрессию GUS под минимальным промотором ELIP влияет расположение элементов только с обеих стороны от экспрессионной кассеты. На экспрессию GFP под сильным растительным промотором RuBisCO влияют оба расположения исследуемых элементов, причем при фланкировании с обеих сторон в два раза сильнее, чем с одной. Это говорит о различии в механизмах регуляции экспрессии с вирусных и растительных промоторов, что вероятно обусловлено более сложной организацией растительного генома и самих промоторов. Эти различия так же можно увидеть при использовании растительных регуляторных элементах ATs, которые оказывают значительно большее влияние на экспрессию с растительных промоторов. Влияние растительных регуляторных элементов сравнимо по своей эффективности с влиянием вирусных последовательностей в идентичных позициях и их использование позволяет довести экспрессию с растительного промотора (RuBisCO) до уровня сильного вирусного промотора (35S).

4. Выводы:

1 Синтетические элементы, созданные на основе терминаторов генов агробактериального nos и вирусного 35S CaMV происхождения, усиливают экспрессию гетерологичных генов в растениях под сильным вирусным промотором 35S CaMV при локализации перед промотором.

2 Показано, что расположение растительных ДНК-элементов, терминирующих транскрипцию (ATs), при любом расположении относительно кассеты экспрессии оказывает более сильное влияние на экспрессию генов под растительными промоторами по сравнению с вирусными. Увеличение уровня экспрессии прямо коррелирует с «силой» промотора как растительного, так и вирусного происхождения.

3 Показано, что расположение ДНК-элементов как с одной, так и с обеих сторон экспрессионной кассеты усиливает экспрессию генов с сильного растительного промотора RuBisCO. Экспрессию с сильного вирусного промотора 35S CaMV усиливают ДНК-элементы расположенные только с 5'-конца гена. На слабые промоторы 35S min и ELIP влияние элементов менее выражено.

4 Установлено, что растительные ДНК-элементы, терминирующие транскрипцию (ATs), при размещении с обеих сторон экспрессионной кассеты снижают позиционный эффект и эффект копийности до двух раз при экспрессии, под контролем сильного растительного промотора RuBisCO.

5. Список работ, опубликованных по теме диссертации

Статьи в научных журналах:

1. A.S. Dolgova, S.V. Dolgov, N.N. Nazipova, O.G. Maksimenko, P.G.

Georgiev. «Arabidopsis termination elements increase transgene expression in tobacco plants», 2015. Plant Cell, Tissue and Organ Culture Volume 120, Issue 3, 1107-1116. DOI 10.1007/s11240-014-0667-1

Патенты:

1. О.Г. Максименко, А.С. Долгова, А.Н. Бончук, М.В. Тихонов, Н.Б. Гасанов, Е.И. Зарайский, С.В. Долгов, П.Г. Георгиев. Способ создания трансгенных растений с высоким уровнем экспрессии трансгенного белка. Патент

2507736. Дата приоритета 11.01.2011.

Тезисы конференций:

1. Dolgova A, Zaripova D, Dolgov S, Georgiev P, Maksimenko O. Artificial regulatory elements, which enables stable expression of a foreign gene in a tobacco plants. In P. Gustafson (Eds.), Proceedings of the 9th International Plant Molecular Biology Congress: Saint Louis, Missouri USA, October 25-30, p. 190. Lancaster, Pa.: DEStech Publications, 2009.

2. Долгова А.С., Пушин А.С., Долгов С.В., Георгиев П.Г., Максименко О.Г.

«Синтетические регуляторные элементы, позволяющие стабилизировать экспрессию гетерологичных генов в растениях табака». 14-я Международная Пущинская Школа-Конференция Молодых Ученых «Биология- Наука XXI Века», стр. 130, Пущино, Россия, 2010.

3. Долгова А.С., Пушин А.С., Долгов С.В., Георгиев П.Г., Максименко О.Г.

«Синтетические регуляторные элементы позволяющие стабилизировать экспрессию гетерологичных генов в растениях табака». Международная научно-практическая конференция молодых ученых «Современнная биотехнология: фундаментальные проблемы, инновационные проекты и бионанотехнология», стр. 43-48. Брянск, Россия, 2010.

4. Максименко О.Г., Долгова А.С., Бончук А.Н., Долгов С.В., Георгиев П.Г.

«Создание генетических конструкций на основе регуляторных элементов, обеспечивающих высокоэффективную, стабильную экспрессию гетерологичных генов в растительных экспрессионных системах и поиск новых цис-регуляторных элементов растений». Всероссийская научная конференция «Ориентированные фундаментальные исследования и их реализация в области хранения и переработки сельскохозяйственной продукции», стр. 58-61. Москва, Россия, 2010.

Автор выражает благодарность сотрудникам станции искусственного климата «Биотрон» филиала ИБХ РАН за помощь в проведении исследований и за многочисленные ценные советы.

Автор выражает благодарность коллективу лаборатории биоинформатики Института математических проблем биологии РАН, в частности Назиповой Нафисе Наиловне, за помощь в проведении математической обработки данных и Смирнову Вадиму Эдуардовичу (Лаборатория вычислительной экологии ИМПБ РАН) за помощь в проведении статистического анализа и интерпретации полученных результатов.



Похожие работы:

«Акопов Сергей Борисович СТРУКТУРНО-ФУНКЦИОНАЛЬНЫЙ АНАЛИЗ ЭНХАНСЕРНЫХ И ИНСУЛЯТОРНЫХ СИСТЕМ РЕГУЛЯЦИИ ТРАНСКРИПЦИИ 03.01.03 молекулярная биология Автореферат диссертации на соискание ученой степени доктора биологических наук МОСКВА – 2015 Работа выполнена в...»

«ГОСУДАРСТВЕННОЕ БЮДЖЕТНОЕ ОБРАЗОВАТЕЛЬНОЕ УЧРЕЖДЕНИЕ ЦЕНТР ОБРАЗОВАНИЯ № 1462 ЮВОУ г. Москвы ВЛИЯНИЕ БИОТИЧЕСКИХ И АБИОТИЧЕСКИХ ФАКТОРОВ СРЕДЫ НА РАЗВИТИЕ АЛЛЕРГИИ У ЧЕЛОВЕКА Автор работы: Смирнова Валентина, ученица 9 класса e-mail: dunkloveyeezy@gmail.com Научный руководитель: Войнова Инесс...»

«МИНИСТЕРСТВО ОБРАЗОВАНИЯ И НАУКИ РОССИЙСКОЙ ФЕДЕРАЦИИ Кемеровский государственный университет Биологический факультет Рабочая программа дисциплины ИНЖЕНЕРНАЯ ГЕОЛОГИЯ Направление подготовки 05.03.01 Геология Направленность (профиль) подготовки Геология Уровень бакалавриата Форма обучения Очная Кемерово 2016 Содержание 1. Пер...»

«Международный Фестиваль "Звезды Нового Века" 2016 Естественные науки (от 14 до 17 лет) Энергетические напитки: "за" и "против" Максимова Евгения, 14 лет ученица 8-го класса Руководитель работы: Афанасов...»

«Сборник материалов Всероссийской научно-практической конференции "Физическая активность подрастающего поколения и взрослого населения России: вовлечение в физкультурно-спортивную деятельность". – СанктПетербург: ФГУ СПбНИИФК, 2010. 130 с. В сборнике представлены результаты научн...»

«Н а п равах рукопи си БОБРОВСКАЯ Наталия Евгеньевна ФОРМИРОВАНИЕ СТРУКТУРЫ КРОН ЛИСТВЕННЫХ И ХВОЙНЫХ ДЕРЕВЬЕВ В ОНТОГЕНЕЗЕ. Специальность 03.00.16 Экология АВТОРЕФЕРАТ диссерта MSI а на соискание ученой степени кандидата биологи...»

«Муниципальное бюджетное дошкольное образовательное учреждение "Центр развития ребенка детский сад №39 "Золотой петушок" г. Альметьевска РТ" Сообщение из опыта работы "Экологическое воспитание детей младшего дошкольного возраста через народное творчество" Воспитатель: Серюкова Е.В. 2015г. "Мир, окружающий ребенка – это, прежде всег...»

«Научный журнал НИУ ИТМО. Серия "Экономика и экологический менеджмент" № 3, 2015 УДК 338.1 Использование логарифмических функций для построения моделей устойчивого развития промышленных предприятий Д-р эконом. наук, проф. Сергеева И.Г. irsergeeva@mail.ru Духанина Д.О. diana_dukhanina@rambler.ru...»

«МИНИСТЕРСТВО ОБРАЗОВАНИЯ И НАУКИ РОССИЙСКОЙ ФЕДЕРАЦИИ "Кемеровский государственный университет" Биологический факультет ) Рабочая программа дисциплины ОНКОГЕНЕТИКА Направление подготовки 06.04.01 Биология Направленность (профиль) подготовки "Генетика" Уровень магистратуры Форма обучения очная Кемерово Оглавление 1. Пере...»

«ФЕДЕРАЛЬНОЕ АГЕНТСТВО ПО ОБРАЗОВАНИЮ МОСКОВСКИЙ ГОСУДАРСТВЕННЫЙ СТРОИТЕЛЬНЫЙ УНИВЕРСИТЕТ НАУЧНО-ОБРАЗОВАТЕЛЬНЫЙ Материал ПО ИЗУЧЕНИЮ ЭКОЛОГИЧЕСКИХ ПРОБЛЕМ г. МОСКВЫ В СПЕЦИАЛИЗИРОВАННОМ КЛАССЕ НА БАЗЕ МГСУ для учащихся средних школ г. Москвы по инженерной специальности "Экология городс...»

«ХИМИЯ И ТЕХНОЛОГИЯ РАСТИТЕЛЬНЫХ ВЕЩЕСТВ – V ВСЕРОССИЙСКАЯ НАУЧНАЯ КОНФЕРЕНЦИЯ – Уфа, 2008 Российская академия наук Уральское отделение, Коми научный центр, Институт химии Уфимский научный центр, Институт органической химии Российский фонд ф...»

«БІЯЛАГІЧНЫЯ НАВУКІ 3 БІЯЛАГІЧНЫЯ НАВУКІ УДК 631.452:631.438.2 ДИНАМИКА РАЗЛИЧНЫХ ВИДОВ РАБОТОСПОСОБНОСТИ ДЕТЕЙ ШКОЛЬНОГО ВОЗРАСТА г. ГОМЕЛЯ В. В. Валетов профессор, доктор биологи...»

«Министерство образования и науки Российской Федерации ПРОГРАММА-МИНИМУМ кандидатского экзамена по специальности 25.00.36 "Геоэкология" (в горнорудной промышленности) по техническим и химическим наукам Программа-минимум содержит 19 стр. Вв...»









 
2017 www.lib.knigi-x.ru - «Бесплатная электронная библиотека - электронные матриалы»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.