WWW.LIB.KNIGI-X.RU
БЕСПЛАТНАЯ  ИНТЕРНЕТ  БИБЛИОТЕКА - Электронные материалы
 

«ISSN 2071-6176 ИЗВЕСТИЯ ТУЛЬСКОГО ГОСУДАРСТВЕННОГО УНИВЕРСИТЕТА Естественные науки Выпуск 4 ТУЛА ИЗДАТЕЛЬСТВО ТулГУ УДК 50 ISSN 2071-6176 Известия ТулГУ. Естественные науки. Вып. ...»

Министерство образования и науки Российской Федерации

Федеральное государственное бюджетное образовательное учреждение

высшего профессионального образования

«Тульский государственный университет»

ISSN 2071-6176

ИЗВЕСТИЯ

ТУЛЬСКОГО ГОСУДАРСТВЕННОГО

УНИВЕРСИТЕТА

Естественные науки

Выпуск 4

ТУЛА

ИЗДАТЕЛЬСТВО ТулГУ

УДК 50 ISSN 2071-6176 Известия ТулГУ. Естественные науки. Вып. 4. — Тула: Изд-во ТулГУ, 2014. — 203 с.

В выпуске опубликованы оригинальные статьи по актуальным проблемам математики, механики, прикладной математики и информатики, биологии, наукам о Земле.

Материалы предназначены для научных работников, преподавателей вузов, студентов и аспирантов, специализирующихся в области естественных наук.

Редакционный совет М.В. Грязев, д-р техн. наук, проф. — председатель, В.Д. Кухарь, д-р техн.

наук, проф. — зам. председателя, А.А. Маликов, д-р техн. наук, проф. — отв. секретарь, В.В. Прейс, д-р техн. наук, проф. — главный редактор, В.А. Алфёров, канд. хим. наук, доц., И.А. Батанина, д-р полит. наук, проф., О.И. Борискин, д-р техн. наук, проф., Л.А. Васин, д-р техн. наук, проф., В.И. Иванов, д-р физ.-мат. наук, проф., Н.М. Качурин, д-р техн. наук, проф., Р.А. Ковалев, д-р техн. наук, доц., А.А. Сычугов, канд. техн. наук, доц., А.К. Талалаев, д-р техн. наук, проф., А.Н. Чуков, д-р техн. наук, проф.



Редакционная коллегия В.И. Иванов (Тула) — отв. редактор, В.А. Алфёров (Тула), С.В. Анциферов (Тула), И.М. Буркин (Тула), Н.М. Добровольский (Тула), Д.М. Левин (Тула), А.А. Маркин (Тула) — зам. отв. редактора, Е.Н. Музафаров (Тула), Л.А. Толоконников (Тула), С.А. Скобельцын (Тула) — отв. секретарь, В.Г. Кротов (Минск, Беларусь), В.В. Литвиненко (Харьков, Украина), Н.П. Матвейко (Минск, Беларусь), В.М. Мирсалимов (Баку, Азербайджан), Н.Т. Темиргалиев (Астана, Казахстан), М.Ш. Шабозов (Душанбе, Таджикистан) Подписной индекс 27845 по Объединенному каталогу «Пресса России»

«Известия ТулГУ» входят в перечень ведущих научных журналов и изданий, выпускаемых в Российской Федерации, в которых должны быть опубликованы научные результаты диссертаций на соискание ученой степени доктора наук Авторы научных статей, 2014 c Издательство ТулГУ, 2014

–  –  –

Суперпродукция, очистка и характеристика транскрипционного фактора SgpR И. Ю. Филатова, Е. Н. Музафаров, М. В. Захарова Аннотация. Салицилат является ключевым интермедиатом бактериальной деградации ряда ароматических углеводородов и может быть использован многими микроорганизмами в качестве единственного источника углерода и энергии. Однако, о механизмах регуляции транскрипции генов катаболизма салицилата известно крайне мало. В данной статье приводится описание конструирования штамм – продуцента белка – регулятора транскрипции генов деградации салицилата (SgpR). Представлена оптимизированная схема очистки His-меченного рекомбинантного белка для получения высококонцентрированного функционально-активного SgpR.

Ключевые слова: фактор транскрипции, SgpR, салицилат, хроматография.

Введение Адаптация микроорганизмов к загрязнениям окружающей среды привела к появлению генетических систем деградации поллютантов.

Существуют штаммы способные использовать такие ксенобиотики как нафталин, фенантрен, антрацен в качестве единственных источников углерода и энергии [1]. Ферментные системы таких штаммов являются индуцируемыми. Так, синтез нафталиндиоксигеназы и ряда других ферментов катаболизма нафталина зависит от присутствия в окружающей среде салицилата, ключевого интермедиата бактериальных путей деградации нафталина [2].





Известно два пути бактериальной деградации нафталина. Первый путь – это тот, который контролируется «классическими», детально исследованными, nah-оперонами, т.е. трансформация нафталина до интермедиатов цикла Кребса через салицилат и катехол. Второй путь – это утилизация нафталина через образование и последующее окисление салицилата и гентизата. Штамм Pseudomonas putida AK5, который относится к –протеобактериям, первый описанный природный штамм, в * Работа выполнена при финансовой поддержке РФФИ (грант № 13-04-01037 A).

Суперпродукция, очистка и характеристика транскрипционного фактора SgpR 175 котором присутствуют как «классический» nah1 -оперон, так и sgp-оперон (salicylate – gentisate pathway) [3].

В настоящий момент наиболее изучены регуляторные белки NagR «гентизатного» пути представителей –протеобактерий, штаммов Ralstonia sp. strain U2 и Polaromonas naphthalenivorans CJ2, гомологичные NahR белкам nah-оперонов деградации салицилата штаммов P. putida G7 (pNAH7) и P. putida NCIB9816-4 (pDTG1) [4, 5]. Однако о регуляции транскрипции генов катаболизма салицилата известно крайне мало.

Белок SgpR штамма P. putida AK5 имеет низкую гомологию с указанными выше транскрипционными факторами, а значит, для выявления механизма регуляции, в первую очередь требуется определить сайт связывания для исследуемого белка. Для этого необходимо было получить высококонцентрированный и функционально-активный препарат белка.

Материалы и методы Бактериальные штаммы и плазмидные векторы Штамм P. putida AK5 был предоставлен лабораторией биологии плазмид Института биохимии и физиологии микроорганизмов Г.К. Скрябина РАН (Россия, г. Пущино).

Для клонирования и экспрессии гена, кодирующего белок – регулятор SgpR, использовали штамм Escherichia coli M15 [pREP4] (F, (pro-lac), thi, 80d, lacZ, M15, ara, rpsL, recA) [6]. Для конструирования рекомбинантной плазмиды в качестве вектора использовали плазмиду pQE30 (Apr ) [7].

Клонирование гена, кодирующего регуляторный белок SgpR Плазмидную ДНК штамма P.putida AK5 выделяли методом щелочного лизиса по Маниатису [8]. Ген sgpR амплифицировали методом ПЦР, используя в качестве матрицы плазмиду pAK5 (GenBank FJ869885), с применением специфических праймеров (sgpR_BamH1 (for) 5 cgcggatccatgatccgtttgcaggacg 3 и sgpR_HindIII (rev) 5 cccaagctttcactcggcgaacatctcg 3 ), содержащих сайты рестрикции BamHI и HindIII.

Ампликон и вектор подвергали обработке эндонуклеазами рестрикции BamHI и HindIII («Fermentas», Литва) при 37 С в течении полутора часов. Затем проводили обработку лигазой фага Т4 («Fermentas», Литва) при температуре 16 С в течение 12 часов и дополнительно обрабатывали рестриктазой KpnI («Fermentas», Литва). После чего, трансформировали компетентные клетки полученной конструкцией.

Трансформация компетентных клеток рекомбинантной плазмидой В качестве компетентных клеток использовали штамм E. coli M15 [pREP4]. 20 мкл реакционной смеси после лигирования вносили в 100 мкл клеточной суспензии. Инкубировали во льду в течение часа, подвергали тепловой обработке при 42 С в течение 2 минут и снова переносили в лед.

176 И. Ю. Филатова, Е. Н. Музафаров, М. В. Захарова Далее, в пробирку вносили 300 мкл среды LB и культивировали около часа при 37 С. Полученную смесь высевали на чашки Петри с агаризованной средой LB и добавлением ампициллина, в конечной концентрации 100 мкг/мл, и канамицина, в конечной концентрации 25 мкг/мл, и выдерживали в течение 16 часов в суховоздушном термостате при температуре 37 С до появления выраженных колоний.

Разрушение клеток и хроматографическая очистка Клетки разрушали на ультразвуковом дезинтеграторе «MSE-150 Watt»

(Англия) в течение 1 минуты (5 циклов по 20 сек.) при 4 С. Полноту разрушения контролировали по снижению мутности суспензии при 590 нм.

Клеточные обломки и тельца включения осаждали центрифугированием в течение 1 ч при 15 000 об/мин на центрифуге K-24 (Германия) при 4 С.

Очистку белка проводили методом аффинной хроматографии на металл-хелатной колонке Ni-NTA фирмы «Qiagene» (США) в соответствии с прилагаемым протоколом.

Электрофорез в ПААГ Электрофорез проводили в течение 1.5 часов при постоянной силе тока 14–15 мА в трис-глициновом буфере (25 мМ трис-ОН, 190 мМ глицин, 0,1 % ДДС-Na), рН 8.3–8.5.

В качестве стандартов использовали белки из набора фирмы «Pharmacia» (Швеция) с молекулярными массами: 66 кДа – БСА, 45 кДа

– овальбумин, 36.0 кДа – глицеральдегид-3-фосфатдегидрогеназа, 29 кДа – карбонангидраза, 24.0 кДа – трипсиноген, 20.1 кДа – ингибитор трипсина, 14.2 – -лактальбумин. Гели окрашивали 0.2 % кумасси бриллиантовым синим G-250 («Bio-Rad», США).

Электрофорез ДНК и ДНК-белковых комплексов проводили в нативных условиях на приборе фирмы Bio-Rad (США). В качестве буфера использовали 1х ТАЕ. Электрофорез проводили в течение 20 минут при напряжении 70 В, затем в течение 50 минут при напряжении 100 В.

EMSA (Electrophoretic Mobility Shift Assay) Фрагмент ДНК длиной 185 п.н., содержащий межгенную область с флангами, амплифицировали с плазмидной ДНК штамма P. putida AK5 со специфическими праймерами, мечеными карбоксифлуоресцеином (FAM) (sgpR – sgpA_5 (for) FAM-5 ggtacagcagctgaaacacc3 и sgpR – sgpA_1.2 (rev) FAM-5 caagagttccatggttggctac 3 ). Комплексы с белком SgpR формировали в буфере Tango («Thermo Scientic», США) в течение 16 минут при 25 С.

Результаты и обсуждение Для детального исследования факторов транскрипции прокариот необходимо наличие высококонцентрированного препарата белка, который возможно получить только в бактериальной экспрессионной системе. Суперэкспрессия и очистка рекомбинантных белков является многоступенчатой задачей, каждый этап которой зависит от множества Суперпродукция, очистка и характеристика транскрипционного фактора SgpR 177 факторов. Регуляторные белки LysR – семейства, к которому относится и исследуемый транскрипционный фактор SgpR, склонны агрегировать между собой и плохо поддаются наработке в препаративных количествах [9]. Существует ряд подходов, позволяющих получить целевой белок в растворимой форме. Сюда входят подбор экспрессионного вектора, позволяющего получить гибридные полипептиды с аффинными метками, повышающими растворимость целевого продукта; оптимизация состава питательной среды, температуры культивирования; определение концентрация химического индуктора.

В данной работе выбор экспрессионного вектора pQE30 (Apr ) был обусловлен тем, что после Т5 промотора и стартового кодона (Met) в нем присутствует нуклеотидная последовательность, кодирующая шесть аминокислотных остатков гистидина, пришивка которых позволяет проводить выделение и очистку белка в одну стадию на аффинном сорбенте.

Данные, по подбору оптимальной температуры и конечной концентрации индуктора сильно варьируются [10, 11], независимо от того, что указанные белки относятся к одному семейству транскрипционных факторов. Часто в биотехнологических процессах конечная концентрация ИПТГ составляет 1 мМ, однако такие процессы направлены, в основном, на последующую денатурацию – ренатурацию телец включения, в которых находится целевой продукт [12].

Для оптимизации стандартного протокола индукции мы провели ряд экспериментов с использованием различных концентраций ИПТГ (изопропил--D-1-тиогалактопиранозид, аналог метаболита лактозы) (от

0.02 мМ до 1 мМ) и различной температуры индукции.

Индукция в стандартных условиях включает в себя выращивание культуры клеток при 37 С в течение двух часов до оптической плотности OD590 = 0.5 (логарифмическая фаза роста), добавление ИПТГ в конечной концентрации 1 мМ. Общее время индукции составило 5 часов. В этих условиях, в применяемой экспрессионной системе, осуществлялся неправильный фолдинг белка и весь целевой продукт накапливался в цитоплазме в виде телец включения. В некоторых случаях уменьшение конечной концентрации ИПТГ приводит к увеличению доли растворимого белка в препарате [13]. Снижение концентрации ИПТГ до 0,5 мМ не оказало влияния на конечный выход целевого белка в клетке. Весь белковый продукт по-прежнему находился в виде телец включения.

Для некоторых транскрипционных факторов показано увеличение доли растворимой формы белка при пониженной температуре индукции [9].

Снижение температуры индукции до 16 С привело к появлению целевого белка в экстракте, однако содержание белка в конечном препарате было достаточно небольшим, около 60 нг/мкл (рис. 1).

Снижение конечной концентрации ИПТГ с 0,5 мМ до 0,2 мМ привело к увеличению содержания белка в препарате с 60 нг/мкл до 100 нг/мкл.

Конечный выход целевого продукта с 200 мл среды составил 50 мкг 178 И. Ю. Филатова, Е. Н. Музафаров, М. В. Захарова Рис. 1.

Электрофореграмма фракций белков, полученных при культивировании экспрессионного штамма при 37 С и 16 С (конечная концентрация ИПТГ 0,5 мМ) М – маркеры молекулярного веса:

1 – гомогенат; 2 – экстракт; 3 – образец после диализа рекомбинантного белка SgpR (рис. 2). Дальнейшее снижение конечной концентрации ИПТГ в питательной среде до 0,02 мМ повысило содержание белкового продукта до 254 нг/мкл. Выход целевого продукта с 200 мл среды составил 127 мкг белка SgpR (рис. 3).

Рис. 2.

Электрофореграмма фракций белков, полученных при культивировании экспрессионного штамма при 16 С (конечная концентрация ИПТГ 0,2 мМ) М – маркеры молекулярного веса:

1 – гомогенат; 2 – экстракт; 3 – образец после диализа Отметим, что образец после диализа содержал целевой белок в форме мономера (молекулярная масса 33,8 кДа). Помимо мономера, на представленных электрофореграммах присутствует полоса, интенсивность Суперпродукция, очистка и характеристика транскрипционного фактора SgpR 179 Рис. 3. Электрофореграмма фракций белков, полученных при культивировании экспрессионного штамма при 16 С (конечная концентрация ИПТГ 0,02 мМ) М – маркеры молекулярного веса:

1 – гомогенат; 2 – экстракт; 3 – образец после диализа которой возрастает с увеличением содержания целевого белка в конечном препарате, что, вероятно, указывает на присутствие белка SgpR в форме димера.

Элюцию белка проводили ступенчатым градиентом концентраций имидазола. В соответствии со стандартным протоколом, после промывки хроматографической колонки 8 мл промывочного буфера собирали фракции по 0,5 мл, используя растворы имидазола в концентрациях 50 мМ, 75мМ, 100 мМ, 125 мМ, 150 мМ, 200 мМ, 250 мМ. Однако подобная схема эксперимента привела к тому, что белок элюировался в диапазоне концентраций 150–200 мМ. В результате, получали достаточно разбавленный препарат белка. Более того, практически все собранные фракции содержали в себе примеси других внутриклеточных белков экспрессионного штамма. Увеличение объема промывочного раствора, проходящего через колонку с адсорбированным белком, до 15 мл позволило очистить хроматографическую колонку от примесей, а уменьшение количества ступеней в градиенте концентраций имидазола до двух (75 мМ и 250 мМ) привело к увеличению содержания целевого белка SgpR в каждой собранной фракции.

Выход очищенного белка из растворимой фракции клеточного лизата представлен в таблице.

Для последующего хранения и использования белок диализовали против буфера, содержащего 25 мМ натрий-фосфатного буфера, pH 8,0; 300 мМ NaCl; 50% глицерина. Концентрацию очищенного белка определяли с помощью спектрофотометра Nanodrop ND-1000 (США).

Хранение при температуре – 20 C привело к снижению содержания растворимой формы белка в препарате. Через две недели количество функционально-активного белка SgpR составило 10% от первоначального.

Хранение при температуре – 70 C позволило использовать препарат белка в течение более продолжительного периода времени. Через месяц количество функционально-активного белка составило 10% от первоначального. В 180 И. Ю. Филатова, Е. Н. Музафаров, М. В. Захарова Подбор оптимальных условий для индукции синтеза белка SgpR

–  –  –

процессе хранения белка SgpR образовывались агрегаты, которые удаляли путем центрифугирования при 11 000 об/мин и температуре 4 C.

Функциональную активность полученного препарата проверяли методом EMSA (Electrophoretic Mobility Shift Assay). Предварительно, с помощью программы BProm сайта SoftBerry в области между дивергентно транскрибируемыми генами sgpR и sgpA были обнаружены последовательности, которые могли бы быть потенциальными промоторами указанных генов. Комплекс фрагмента ДНК, содержащий межгенную область с флангами, с регуляторным белком SgpR формировали в течение 16 минут при 25 С. Визуализировали комплексы с помощью электрофореза в 7% ПААГ в нативных условиях. Результат электрофоретического разделения свободной ДНК и ДНК-белковых комплексов представлен на рис. 4.

Рис. 4. Изменение электрофоретической подвижности фрагмента ДНК при связывании с белком SgpR Наблюдалось изменение электрофоретической подвижности фрагментов ДНК. При добавлении в реакционную смесь белка SgpR в концентрации 50 нМ происходило связывание всех фрагментов ДНК. А это значит, Суперпродукция, очистка и характеристика транскрипционного фактора SgpR 181 полученный препарат белка функционально-активен и может быть использован для дальнейших биохимических исследований.

Заключение В настоящей работе провели оптимизацию схемы экспрессии и хроматографической очистки транскрипционного фактора SgpR. Индукцию проводили при 16 С в течение 16 часов и добавлении ИПТГ в конечной концентрации 0,02 мМ. В ходе очистки на металл-хелатной колонке белок элюировали ступенчатым градиентом концентраций имидазола (75 мМ и 250 мМ).

Представленная схема индукции и очистки позволила получить препарат с содержанием белка 254 нг/мкл. Очищенный белок сохранял свою функциональную активность в течение недели, если его хранить при – 20 С и в течение 3-х недель при – 70 С. Полученный препарат можно использовать для исследования механизма регуляции транскрипции генов sgp-оперона.

Благодарности Авторы выражают благодарность за ценные советы сотрудникам лаборатории биологии плазмид Института биохимии и физиологии микроорганизмов им. Г.К. Скрябина РАН Кошелевой И.А., Измалковой Т.Ю., Сазоновой О.И.

Список литературы

1. Тимергазина И.Ф., Переходова Л.С. К проблеме биологического окисления нефти и нефтепродуктов углеводородокисляющими микроорганизмами // Нефтегазовая геология. Теория и практика. 2012. Т. 7. № 1. С. 235–263.

2. Tropel D., Meer J.R. Bacterial Transcriptional Regulators for Degradation Pathways of Aromatic Compounds // Microbiology and molecular biology reviews. 2004. V. 68.

No. 3. P. 474–500.

3. The organization of naphthalene degradation genes in Pseudomonas putida strain AK5 / T.Yu. Izmalkova [et al.] // Research in Microbiology. 2013. V. 164. P. 244–253.

4. The naphthalene catabolic (nag) genes of Ralstonia sp. strain U2 are an operon that is regulated by NagR, a LysR-type transcriptional regulator / R.M. Jones [et al.] // Journal of bacteriology. 2003. V. 185. No. 19. P. 5847–5853.

5. The naphthalene catabolic (nag) genes of Polaromonas naphthalenivorans CJ2:

evolutionary implications for two gene clusters and novel regulatory control / C.O. Jeon [et al.] // Appl. Environ. Microbiol. 2006. V. 72. P. 1086–1095.

6. Groger R.K., Morrow D.M., Tykocinski M.L. Directional antisense and sense cDNA cloning using Epstein-Barr virus episomal expression vectors // Gene. 1989. V. 81.

P. 285–294.

182 И. Ю. Филатова, Е. Н. Музафаров, М. В. Захарова

7. A T5 promotor based transcription-translation system for the analysis of proteins in vivo and in vitro / H. Bujard [et al.] // Methods in Enzymology. 1987. V. 155.

P. 416–433.

8. Маниатис Т., Фрич Э., Сэмбрук Дж. Методы генетической инженерии.

Молекулярное клонирование. М.: Мир, 1984. 480 c.

9. Crystallization and preliminary X-ray analysis of CrgA, a LysR-type transcriptional regulator from pathogenic Neisseria meningitidis MC58 / S. Sainsbury [et al.] // Acta Crystallographica. 2008. V. 64. P. 797–801.

10. Park H.H., Lim W.K., Shin H.J. In vitro binding of puried NahR regulatory protein with promoter Psal // Biochimica et Biophysica Acta. 2005. V. 1725.

P. 247–255.

11. Lin L.-X., Liu H. a, Zhou N.-Y. MhbR, aLysR-typeregulatorinvolvedin 3-hydroxybenzoate catabolism via gentisate in Klebsiellapneumoniae M5a1 // Microbiological Research. 2010. V. 165. P. 66–74.

12. Yamaguchi H., Miyazaki M. Refolding Techniques for Recovering Biologically Active Recombinant Proteins from Inclusion Bodies // Biomolecules. 2014. V. 4. P. 235–251.

13. Потапова А.В., Озолинь О.Н., Тутукина М.Н. Разработка методов эффективной суперпродукции и очистки фактора транскрипции ExuR из Escherichia coli c использованием аффинной хроматографии // Сорбционные и хроматографические процессы. 2014. Т. 14. Вып. 3. С. 537–543.

Филатова Ирина Юрьевна (iralatova24@gmail.com), аспирант, кафедра биотехнологии, Тульский государственный университет; лаборатория молекулярной микробиологии, Институт биохимии и физиологии микроорганизмов им. Г.К. Скрябина РАН, Пущино.

Музафаров Евгений Назибович (enmuzafarov@mail.ru), д.б.н., проф., зав.

кафедрой, кафедра биологии, Тульский государственный университет.

Захарова Марина Викторовна (zemskovam@mail.ru), к.б.н., с.н.с., лаборатория молекулярной микробиологии, Институт биохимии и физиологии микроорганизмов им. Г.К. Скрябина РАН, Пущино.

Overexpression, purication and characterization of the transcription factor SgpR I. Yu. Filatova, E. N. Muzafarov, M. V. Zakharova Abstract. Salicylate is the key intermediate of the bacterial degradation pathway of various aromatic hydrocarbons and it can be used as the sole carbon and energy source by wide range of bacterial species. However, little is known about the transcriptional regulatory mechanisms of the genes involved in salicylate degradation. Here we show the construction of E. coli strain for the overexpression of the salicylate-catabolic regulator SgpR. The scheme of Суперпродукция, очистка и характеристика транскрипционного фактора SgpR 183 purication of the His-tag recombinant protein is properly optimized to obtain the functionally active SgpR with high concentration.

Keywords: transcription factor, SgpR, salicylate, chromatography.

Filatova Irina (iralatova24@gmail.com), postgraduate student, department of biotechnology, Tula State University; laboratory of molecular microbiology, G.K. Skryabin Institute of Biochemistry and Physiology of Microorganisms of RAS, Pushchino.

Muzafarov Evgeny (enmuzafarov@mail.ru), doctor of biological sciences, professor, head of department, department of biology, Tula State University.

Zakharova Marina (zemskovam@mail.ru), candidate of biological sciences, senior research ocer, laboratory of molecular microbiology, G.K. Skryabin Institute of Biochemistry and Physiology of Microorganisms of RAS, Pushchino.

–  –  –



Похожие работы:

«ОЦЕНКА ВЛИЯНИЯ КИСЛОГУБСКОЙ ПРИЛИВНОЙ ЭЛЕКТРОСТАНЦИИ НА ОКРУЖАЮЩУЮ СРЕДУ НА ОСНОВЕ ПРИМЕНЕНИЯ ИМИТАЦИОННОЙ ЭКОЛОГИЧЕСКОЙ МОДЕЛИ ПЭС Е.Ф. Султанова1, С.Н. Сидоренко2, В.С. Орлова2 ОАО "НИИЭС" Строительный проезд, 7, Москва, Россия, 125363 Российский университет дружбы н...»

«Согласовано Утверждаю Зам. директора МБОУ "СОШ с. Шумейка" Директор МБОУ "СОШ с. Энгельсского муниципального района Шумейка" Энгельсского /Архипова О.В./ муниципального района /Плотарева Е.А/ Приказ № от Рабочая учебная программа по уч...»

«ПАРАЗИТОЛОГИЯ, 1, 5, 1967 УДК 595.121 СРАВНЕНИЕ АНТИГЕННОЙ СТРУКТУРЫ ИМАГИНАЛЬНОЙ ФАЗЫ И ПЛЕРОЦЕРКОИДОВ SPIROMETRA ERINACEI Э. Г. Кравцов Кафедра биологии с общей генетикой 1-го Московского медицинского института им. И. М. Сеченова В предыдущих работах (Кравцов, 1965, 1...»

«Распределение, численность и экология отдельных групп и видов птиц РЕДКИЕ ВИДЫ ВОДОПЛАВАЮЩИХ ПТИЦ МОСКВЫ: ДИНАМИКА С 1985 ПО 2014 гг. К.В. Авилова Кафедра зоологии позвоночных, биологический факультет МГУ имени М.В. Ломоносова e-mail: wildli...»

«Тишин Денис Владимирович ВЛИЯНИЕ ПРИРОДНО-КЛИМАТИЧЕСКИХ ФАКТОРОВ НА РАДИАЛЬНЫЙ ПРИРОСТ ОСНОВНЫХ ВИДОВ ДЕРЕВЬЕВ СРЕДНЕГО ПОВОЛЖЬЯ Специальность 03.00.16 – Экология Автореферат диссертации на соискание ученой степени кандидата биологических наук Казань 2006 Раб...»

«Модифицированная программа по курсу "Технология" для неделимых 5-8 классов Обоснование программы Образовательная область "Технология" обеспечивает формирование политехнических и общетрудовых знаний в области технологии, экономики, организации и экологии современного производства, представления о перспективах его развития, о...»

«МАТЕМАТИЧЕСКАЯ БИОЛОГИЯ И БИОИНФОРМАТИКА, 2008, том 3, №2, с.60-68, http://www.matbio.org/downloads/Mikhailova2008(3_60) .pdf =============МАТЕРИАЛЫ II МЕЖДУНАРОДНОЙ КОНФЕРЕНЦИИ============ =========="МАТЕМАТИЧЕСКАЯ БИОЛОГИЯ И БИОИНФОРМАТИКА"========== УДК...»

«22 УДК 582.52(571.1) Систематические заметки., 2012, № 105 Аннотированный список видов Stipa L. (Poaceae) Южной Сибири Annotated list of the Stipa L. species (Poaceae) from South Siberia © П.Д. Гудкова P.D. Gudkova Томский государственный университет, Tomsk State University, Томск, polina-shavrova@...»

«http://www.bio.bsu.by/dekanat/sportlife2.phtml Страница 1 Распечатать Сайт Биологического Факультета версия для печати или вернуться Годовой план биологического факультета БГУ по спортивно-масс...»

«See discussions, stats, and author profiles for this publication at: https://www.researchgate.net/publication/275352146 [Methodical bases of plant breeding] Book · October 2009 CITATIONS READS 2 authors, including: N. P. Goncharov Institute of Cytology and Ge...»








 
2017 www.lib.knigi-x.ru - «Бесплатная электронная библиотека - электронные материалы»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.